Analysis of biofilm production in Enterococcus faecium strains depending on clinical source

Sieńko A.*#A-E, Wieczorek P.# A-E, Majewski P.B,C, Sacha P.B, Wieczorek A.B, Ojdana D.B, Tryniszewska E.E,F

 

Department of Microbiological Diagnostics and Infectious Immunology, Faculty of Pharmacy, Medical University of Bialystok, Poland

# Both authors contributed equally to this work

 

__________________________________________________________________________________________

 

A- Conception and study design; B - Collection of data; C - Data analysis; D - Writing the paper;

E- Review article; F - Approval of the final version of the article; G - Other (please specify)

__________________________________________________________________________________

 

ABSTRACT

__________________________________________________________________________________


 

Purpose: Enterococcus faecium strainshave been reported worldwide as etiologic factors of many nosocomial infections, which are difficult to manage because of the constantly increasing resistance of these microorganisms to antibiotics and the ability to form biofilm. The aim of this study was to analyze the ability to produce a biofilm in E. faecium strains, depending on the patient’s clinical material.

Materials and methods: Sixty-six E. faecium strains were investigated. Identification and susceptibility testing were conducted by the VITEK2 system. The ability to form biofilm was assessed by phenotypic methods. The presence of selected virulence genes was established by PCR followed by gel electrophoresis and sequencing.

Results:Among the tested E. faecium isolates, 72.7% were biofilm-positive (BIO+) and 27.3% biofilm-negative (BIO-). Strains were collected mostly from rectal swabs (30.4%) and blood

 

(18.3%). BIO+ strains from infections constituted 31.8% (52.4% isolated from blood) and from colonization 40.9% (48.2% from rectal swabs). 91.7% of the Blood Group strains and 68.5% of the Other Group strains produced biofilm. Strains from the Colonization Group produced biofilm in a proportion similar to the Infection Group (about 75%). There were no statistically significant differences in virulence and resistance, except for vancomycin (more resistant BIO+ Other than the BIO+ Blood Group, and more resistant BIO+ Colonization than BIO+ Infection Group) and teicoplanin (more resistant BIO+ Colonization than the BIO+ Infection Group).

Conclusion:The majority of E. faecium isolates carries high levels of resistance to many antimicrobials, is well equipped with virulence genes, and possesses the ability to form biofilm.

Key words: Enterococcus faecium,   biofilm,  antibiotic,  resistance, virulence


__________________________________________________________________________________

 

 

 

 

 

*Corresponding author:

Sieńko Anna

Department of Microbiological Diagnostics and Infectious Immunology

Medical University of Bialystok, 15a Waszyngtona Street, 15-269 Bialystok, Poland

Tel.: + 48 85 746 85 71; e-mail: anna.sienko@umb.edu.pl

 

Received: 02.04.2017

Accepted: 25.05.2017

Progress in Health Sciences

Vol. 7(1) 2017 pp 83-89

© Medical University of Białystok, Poland


INTRODUCTION

 

                Enterococcus faecium strainshave been reported worldwide as etiologic factors of many nosocomial infections, which are difficult to manage because of the constantly increasing resistance of these microorganisms to antibiotics and their ability to form strong biofilms [1,2]. The largest threat is infections caused by vancomycin-resistant E. faecium (VRE), particularly for critically ill or immunocompromised patients [3,4]. Moreover, VRE strains are often simultaneously resistant to β-lactams and aminoglycosides, and are considered multidrug resistant (MDR) [2,4]. Alarmingly, antimicrobial resistance genes from MDR strains can be transferred by transposons or pheromone-mediated conjugative plasmids not only to susceptible enterococcal isolates, but also to other more virulent nosocomial pathogens, like Staphylococcus aureus [5]. Furthermore, E. faecium isolates are characterized by a high frequency of genes encoding putative virulence factors, such as collagen adhesin (acm gene), enterococcal surface protein (esp gene), hyaluronidase (hyl gene), gelatinase (gelE gene), endocarditis antigen (efa gene), and cytolysin (cyl operon) [6].

                The ability to form biofilm among E. faecium strains is considered to be an important virulence property, and these bacteria are often responsible for conditions in which they may be associated with biofilm, such as endocarditis or catheter-associated urinary tract infections [1, 7]. Unfortunately, due to the rapidly increasing number of conflicting literature reports about biofilm formation among enterococci, we still do not know the true impact of biofilm growth on the expression and transfer of resistance and virulence traits, especially among the E. faecium species [8-10].

Moreover, very limited data about biofilm formation, virulence, and antibiotic resistance among E. faecium strains are available in Poland [11]. This prompted us to determine the prevalence of the biofilm-forming ability among E. faecium clinical strains, depending on the patient’s clinical material. In the next step, we searched for differences in resistance and virulence determinants between BIO+ and BIO- E. faecium isolates. This study also aimed to investigate the differences among E. faecium strains isolated from infections and colonization, and to determine differences between strains isolated from blood and  other clinical sources.  

 

MATERIALS AND METHODS

 

Strains

Tests were performed on sixty-six randomly selected E. faecium strains, isolated from clinical specimens from patients hospitalized at the University Hospital in Bialystok (Poland) from December 2013 to January 2015. The majority of strains were collected from intensive care units (42.8%) and a hematology clinic (31.8%).

 

Identification and susceptibility testing

The identification and susceptibility testing of study isolates were conducted on the automated VITEK 2 system (bioMérieux, France) according to the manufacturer’s guidelines using VITEK 2 GP and AST-P516cards, respectively.

Susceptibility to ampicillin, imipenem, gentamicin, streptomycin, vancomycin, teicoplanin, linezolid, and tigecycline was interpreted according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) recommend-dations (breakpoint tables for interpretation of minimum inhibitory concentrations, MIC, and zone diameters; version 5.0. 2015; http://www. eucast.org).

 

Biofilm production

                The Congo red agar (CRA) method [12,13]and the tube method [14,15] were used to assess biofilm-forming ability. Each experiment was repeated three times for each strain. Isolates that demonstrated the ability to form biofilm by both methods were considered biofilm positive (BIO+) strains.

 

Hemolysin production

Hemolysin production was established on Columbia blood agar with 5% sheep blood (OXOID, United Kingdom), as previously described [16].

 

DNA extraction

                Genomic DNA was extracted from overnight E. faecium cultures using a Genomic Mini Kit (A&A Biotechnology, Poland) according to the manufacturer’s instructions.

 

PCR detection of virulence genes

                PCR assays were performed to detect the following virulence genes: gelE, acm, hyl, esp, efaA, and cyl. The primers used in this survey were selected from the literature and their sequences are listed in Table 1. PCR amplification was performed in 25 µl mixtures using 2 µl of DNA solution, 1 µl of each primer, 8.5 µl of nuclease-free water, and 12.5 µl of PCR master mix (DNA Gdańsk, Poland). Samples were subjected to an initial denaturation at 94ᴼC for 5 min, followed by 30 cycles of denaturation at 94ᴼC for 1 min, annealing at an appropriate temperature for 1 min, and elongation at 72ᴼC for 1 min using a DNA thermocycler (SensoQuest GmbH, Germany).


Table 1.PCR primers, annealing temperatures, and product sizes for the detection of virulence genes

virulence gene

primers

product size (bp)

annealing temperature (̊C)

reference

gelE

AAT TGC TTT ACA CGG AAC GG

GAG CCA TGG TTT CTG GTT GT

    548

52

[17]

acm

GGC CAG AAA CGT AAC CGA TA

CGC TGG GGA AAT CTT GTA AA

353

hyl

ACA GAA GAG CTG CAG GAA ATG

GAC TGA CGT CCA AGT TTC CAA

276

55

[18]

 

 

 

esp

AGA TTT CAT CTT TGA TTC TTG G

AAT TGA TTC TTT AGC ATC TGG

510

efaA

CACGCTATTACGAACTATGA

TAAGAAAGAACATCACCACGA

375

cyl

TGG ATG ATA GTG ATA GGA AGT

TCT TTC ATC ATC TGA TAG TA

517

 


 

PCR products were separated electrophoretically on the Sub-Cell GT apparatus (Bio-Rad, USA) at 5 V/cm for 100 min on a 1.5% agarose gel (Sigma-Aldrich, USA) containing 0.5% ethidium bromide (MP Biomedicals, USA) in Tris-borate-EDTA (ethylenediaminetetraacetic acid) buffer. Then, amplicons were visualized and photographed using the ChemiDoc XRS imaging system and Quantity One 1-D analysis software (Bio-Rad). To confirm the presence of the above-mentioned virulence genes, DNA sequencing was carried out on selected PCR products by the GENOMED S.A. company in Poland. The sequences were aligned and compared with reference sequences achieved using GenBank with the Basic Local Alignment Search Tool (BLAST) algorithm.

 

Statistical analysis

STATA 13.1 (StataCorp LP, USA) was used for statistical analysis. Differences between various groups of E. faecium strains were assessed using the Chi-square and Fisher’s exact tests. Results with p<0.05 were considered significant.

 

RESULTS

 

Sixty-six E. faecalis strains were divided into various groups based on their source of isolation: Infection Group, strains isolated from blood (18.2%), urine (13.7%), pus (3%), and bronchoalveolar lavage (BAL) (3%); Colonization Group, isolates from rectal swabs (30.3%), feces (12.1%), pharyngeal swabs (7.6%), and groin swabs (3%); Blood Group, isolates only from blood (18.2%); and Other Group, isolates from all other clinical materials (71.8%). Moreover, after determining the biofilm-forming ability of all tested E. faecium strains, we created BIO+ (72.7%) and

 

BIO- (27.3%) groups. We also divided the previous groups into BIO+ subgroups: BIO+ Infection/BIO+ Colonization, and BIO+ Blood/BIO+ Other.

                The exact characteristics of differences in virulence and antibiotic resistance between the tested E. faecium groups are presented in Table 2. A significant difference (p=0.001) was reported only in the case of the phenotypic ability to hemolyze (97.9% BIO+ and 72.2% BIO-). The most frequent virulence genes among the tested isolates were acm (>95.5%) and efa (>81.8%). There were no statistically significant differences in the prevalence of all tested virulence genes (p>0.05).

                All tested E. faecium groups showed high resistance to ampicillin (>96.3% resistant isolates) and imipenem (>94.4% resistant isolates). Resistance to gentamicin was detected in more than 41.7% of the tested isolates, whereas more than 81.5% were resistant to streptomycin. Differences between the various groups of E. faecium were not statistically significant (p>0.05), except for glycopeptides (Table 2). In the case of vancomycin, 71.1% of E. faecium from the Colonization group and 17.9% of E. faecium from the Infection group (p<0.001), 70.4% of the BIO+ Colonization group and 19% of the BIO+ Infection Group (p<0.001), 55.6% of other, 16.7% of blood isolates (p=0.015), 56.8% of BIO+ other, and 18.2% of BIO+ blood isolates (p=0.026) were resistant. Resistance to teicoplanin was detected in 63.2% of strains from the Colonization group and 14.3% of strains from the Infection group (p<0.001), in 59.3% of the BIO+ Colonization group and 14.3% of the BIO+ Infection group (p<0.001), and in 48.1% of other and 16.7% of blood isolates (p=0.046). Linezolid and tigecycline had the highest activity against all studied isolates (100% susceptibility).

 


Table 2. Characteristics and statistical analysis (Chi square test, significance level α=0.05) of differences in virulence and antibiotic resistance between the tested E. faecium groups; BIO+, biofilm-positive; BIO-, biofilm-negative; n, number of strains; acm, collagen adhesin; gelE, gelatinase; esp, enterococcal surface protein; hyl, hyaluronidase; efa, endocarditis antigen; cyl, cytolysin; AMP, ampicillin; IMP, imipenem; GN, gentamicin; S, streptomycin; VA, vancomycin; TEI, teicoplanin; TG, tigecycline; LZD, linezolid;  *lack of differences between groups.

 

virulence

 

strains

n

hemolysis

p

acm

p

gelE

p

esp

p

hyl

p

efa

p

cyl

p

BIO+

48

97.9%

0.001

97.9%

0.117

4.2%

0.809

87.5%

0.138

83.3%

*

89.6%

0.154

2.1%

0.463

BIO-

18

72.2%

88.9%

5.6%

72.2%

83.3%

100%

5.6%

Infection

28

92.9%

0.636

100%

0.128

0%

0.128

85.7%

0.656

85.7%

0.656

89.3%

0.408

0%

0.218

Colonization

38

90.9%

95.5%

4.5%

83.3%

83.3%

92.4%

3%

BIO+ Infection

21

100%

0.373

100%

0.373

0%

0.203

85.7%

0.741

90.5%

0.241

85.7%

0.439

0%

0.373

BIO+ Colonization

27

96.3%

96.3%

7.4%

88.9%

77.8%

92.6%

3.7%

Blood

12

100%

0.226

100%

0.403

0%

0.403

91.7%

0.392

83.3%

*

83.3%

0.188

0%

0.498

Other

54

88.9%

94.4%

5.6%

81.5%

83.3%

94.4%

3.7%

BIO+ blood

11

100%

0.582

100%

0.582

0%

0.430

90.9%

0.697

81.8%

0.878

81.8%

0.337

0%

0.582

BIO+ other

37

97.3%

97.3%

5.4%

86.5%

83.8%

91.9%

2.7%

 

antibiotic resistance

 

 

 

AMP

p

IMP

p

GN

p

S

p

VA

p

TEI

p

TG/LZD

p

BIO+

48

97.9%

0.464

100%

0.273

62.5%

0.917

83.3%

0.575

47.9%

0.880

39.6%

0.446

0%

*

BIO-

18

94.4%

94.4%

61.1%

88.9%

50%

50%

0%

Infection

28

96.4%

0.826

96.4%

0.240

60.7%

0.840

85.7%

0.866

17.9%

<0.001

14.3%

<0.001

0%

*

Colonization

38

97.4%

100%

63.2%

84.2%

71.1%

63.2%

0%

BIO+ Infection

21

100%

0.372

100%

*

61.9%

0.940

85.7%

0.696

19%

<0.001

14.3%

<0.001

0%

*

BIO+ Colonization

27

96.3%

100%

63%

81.5%

70.4%

59.3%

0%

Blood

12

100%

0.498

100%

0.635

41.7%

0.129

91.7%

0.466

16.7%

0.015

16.7%

0.046

0%

*

Other

54

96.3%

98.1%

63%

83.3%

55.6%

48.1%

0%

BIO+ blood

11

100%

0.582

100%

*

45.5%

0.183

90.9%

0.443

18.2%

0.026

18.2%

0.098

0%

*

BIO+ other

37

97.3%

100%

67.6%

81.1%

56.8%

45.9%

0%


DISCUSSION

 

Our results revealed that 72.7% of the tested E. faecium strains had the ability to form biofilm. Studies by other authors showed different results; in India, Italy, and Turkey, the percentages of BIO+ E. faecium strains were much lower (25.2%, 28.8%, and 48%, respectively) [8, 19, 20]. When comparing strains from the Infection Group with strains from the Colonization Group, we found that this ability was on a similar level (75% and 72.7%, respectively). Di Rosa et al. [8] described only 35.7% of biofilm-producing E. faecium isolated from infections. In our survey, the highest difference in biofilm formation was observed when comparing the Blood Group with the Other Group (91.1% and 68.5%, respectively), but it was statistically insignificant (p=0.103). Researchers from Greece [7] detected 55.9% of BIO+ E. faecium strains in blood isolates, while our study revealed that all strains from the analogous group had this ability. Thus, worryingly, we can consider that the percentages of BIO+ E. faecium strains in our hospital are very high, and the appropriate surveillance methods should be implemented.

                According to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) interpretation tables for clinical breakpoints, almost all (>95%) E. faecium isolates were resistant to tested ß-lactams, and more than 60% showed high levels of resistance to aminoglycosides. Moreover, in this research we observed very high rates of resistance to glycopeptides: 48.5% strains were VRE, and 42.4% were also resistant to teicoplanin. Likewise, the latest research conducted in our hospital revealed similar levels of resistance among E. faecium strains [21].Therefore, we can conclude that the problem with MDR E. faecium isolates in our hospital environment is large and the infections caused by these strains should not be underestimated. The only antimicrobial agents that showed 100% activity against these strains were tigecycline and linezolid. These findings are consistent with previous surveys that describe these drugs as valuable therapeutic options in infections caused by MDR Enterococcus strains, although their clinical use is limited [21-23].

                Taking into account the levels of resistance among the tested groups and subgroups, we found no statistically significant differences, except for vancomycin and teicoplanin (Table 2). In the case of our isolates from the Blood Group, we found very high levels of resistance to all tested antibiotics (except linezolid and tigecycline). Previous American research revealed significantly smaller percentages of resistance toward ampicillin (75.6%) and aminoglycosides (about 30%) among E. faecium isolated from blood. However, the same study showed higher levels of resistance to vancomycin (22.2%) [24]. Different results were presented by Saeedi et al. [25], who reported resistance to gentamicin in all E. faecium blood isolates. Interestingly, we revealed no significant differences in antibiotic resistance between BIO+ and BIO- isolates; therefore, the hypothesis that bacteria in biofilms are more resistant to antibiotics than planktonically grown microorganisms [3,9,26,27] is not confirmed in our study.

                Unfortunately, we did not find any statistically significant differences in the prevalence of all tested virulence genes among the tested E. faecium groups (p>0.05). The only significant disparity (p=0.001) was reported in the case of the phenotypic ability to hemolyze: more BIO+ (97.9%) than BIO- (72.2%) strains had this feature, indicating that BIO+ isolates are slightly more virulent than the BIO- group.

The results obtained in this study agree with previous statements that there is no relationship between the occurrence of the esp gene and biofilm formation among Enterococcus strains [3,6,8]. Nevertheless, esp seems to be an important virulence trait among E. faecium strains. Hallgren et al. [28] noticed that it was the only virulence factor found among these species; it occurred in 75% of blood isolates and 70% of rectal isolates. On the other hand, Diani et al. [20] found that 46% of blood and 22% of fecal isolates contained this gene. An American survey conducted concurrently revealed that esp was present in 33% of BIO+ and 53.8% of BIO- isolates [6].

Interestingly, the hyl gene was detected much less frequently, in only 22% of BIO+ and 38.5% of BIO- strains [6]. In our BIO+ Infection Group, 85.7% of strains had the esp gene, while Di Rosa et al. [8] detected it in only 50% of analogous strains. Unfortunately, in our research we observed much higher rates of these genes among corresponding groups. Astonishingly, Tsikrikonis et al. [7] revealed that 83.8% of BIO+ and 26.7% of BIO- E. faecium clinical strains had esp, and 61.9% of BIO+ and 0% of BIO- fecal isolates carried this gene. The authors concluded that the presence of esp has a strong connection with biofilm-forming ability, which is not in concordance with our findings. All of these varied results indicate that esp may require certain interactions with other virulence traits to result in biofilm enhancement; more studies are definitely needed in this area.

                A noteworthy fact is that the presence of cyl and gelE genes among E. faecium strains is very rare [20,28]. Vankerckhoven et al. [29] did not detect any cyl and gelE genes with PCR in 271 E. faecium isolates. In our study, the majority of E. faecium isolates were shown to be cytolysin/hemolysin producers (>89%) on blood agar plates, but only two (3%) strains carried the genes of the cyl operon. This may be due to the expression of other hemolysin genes that are not yet known or not so well studied. Interestingly, we found that these cyl-positive strains also had the gelE gene. A small percentage of strains with the gelE gene have also been reported [30], but without the coexistence of the cyl gene.

 

CONCLUSIONS

 

                In summary, this study demonstrated a lack of significant differences in virulence and resistance among various tested E. faecium groups. Nevertheless, we revealed that all E. faecium isolates in our hospital carry high levels of resistance to many antimicrobials and are extremely well equipped with virulence genes. Furthermore, the majority of these strains were able to form biofilm structures; therefore, they can persist in a hospital environment for a long time. This creates the need for more effective surveillance and an appropriate antibiotic policy. Only a complete understanding of the exact role of resistance and virulence factors in the development of biofilm can lead to improved strategies for the control of infections caused by MDR E. faecium isolates. There is an urgent need for larger multicenter studies to assess reports about levels of resistance and virulence among E. faecium strains in Poland.

 

 

Acknowledgements

We would like to thank Steven J. Snodgrass for his editorial assistance.

The results of this work were presented in part at the Biofilms 7Conference 2016 in Porto, Portugal(06/26-26/2016).

 

Conflicts of interest

The authors have no conflicts of interest to declare.

 

Financial disclosure/funding

This work was supported by funds from the Leading National Research Center (137/KNOW/2015) in Bialystok, Poland.

 

 

REFERENCES

 

1.     Mohamed JA, Huang DB. (2007) Biofilm formation by enterococci. J Med Microbiol. 2007 Dec;56(12):1581-88.

2.     Arias CA, Contreras GA, Murray BE. Management of multidrug-resistant enterococcal infections. Clin Microbiol Infect. 2010 Jun;16(6):555-62.

3.     Raad II, Hanna HA, Boktour M, Chaiban G, Hachem RY, Dvorak T, Lewis R, Murray BE. Vancomycin-Resistant Enterococcus faecium: Catheter Colonization, esp Gene, and Decreased Susceptibility to Antibiotics in Biofilm. Antimicrob Agents Chemother.2005 Dec; 9(12):5046-50.

4.     Sieńko A, Wieczorek P, Wieczorek A, Sacha P, Majewski P, Ojdana D, Michalska A, Tryniszewska E. Occurrence of high-level aminoglycoside resistance (HLAR) among Enterococcus species strains. Prog Health Sci. 2014;4(1):179-87.

5.     Loomba PS, Taneja J, Mishra B. Methicillin and Vancomycin Resistant S. aureus in Hospitalized Patients. J Glob Infect Dis. 2010 Sep-Dec;2(3):275-83.

6.     AlmohamadS, SomarajanSR, SinghK, NallapareddySR, Murray BE. Influence of isolate origin and presence of various genes on biofilm formation by Enterococcus faecium. FEMS Microbiol Lett.2014 Apr; 353(2):151-56.

7.     Tsikrikonis G, Maniatis AN, Labrou M, Ntokou E, Michail G, Daponte A, Stathopoulos C, Tsakris A, Pournaras S. Differences in biofilm formation and virulence factors between clinical and fecal enterococcal isolates of human and animal origin. Microb Pathog.2012 Jun;52(6):336–43.

8.     Di Rosa R, Creti R, Venditti M, D'Amelio R, Arciola CR, Montanaro L, Baldassarri L. Relationship between biofilm formation, the enterococcal surface protein (Esp) and gelatinase in clinical isolates of Enterococcus faecalis and Enterococcus faecium. FEMS Microbiol Lett. Mar;256(1):145-50.

9.     Heikens E, Bonten MJ, Willems RJ. Enterococcal surface protein Esp is important for biofilm formation of Enterococcus faecium E1162. J Bacteriol. 2007 Sep;189(22):8233-40.

10.Akhter J, Ahmed S, Saleh AA, Anwar S. Antimicrobial resistance and in vitro biofilm-forming ability of Enterococci spp. isolated from urinary tract infection in a tertiary care hospital in Dhaka. Bangladesh Med Res Counc Bull. 2014 Apr;40(1):6-9.

11.Dworniczek E, Wojciech Ł, Sobieszczańska B, Seniuk A.Virulence of Enterococcus isolates collected in Lower Silesia (Poland). Scand J Infect Dis. 2005;37(9):630-6.

12.Freeman DJ, Falkiner FR, Keane CT. New method for detecting slime production by coagulase negative staphylococci. J Clin Pathol. 1989 Aug;42(8):872–4.

13.Cabrera-Contreras R, Morelos-Ramirez R, Galicia-Camacho AN, Melendez-Herrada E. Antibiotic resistance biofilm production in Staphylococcus epidermidis strains, isolated from a Tertiary Care Hospital in Mexico City. ISRN Microbiol. 2013;13:1–5.

14.Christensen GD, Bisno AL, Simpsom WA, Beachey EH. Adherence of slime producing strains of Staphylococcus epidermidis to smooth surfaces. Infect Immun. 1982 Jul;37(1): 318-26.

15.Oliveira A, Cunha MD. Comparison of methods for the detection of biofilm production in coagulase-negative staphylococci. BMC Res Notes. 2010 Oct;3:260.

16.Vergis EN, Shankar N, Chow JW, Hayden MK, Snydman DR, Zervos MJ, Linden PK, Wagener MM, Muder RR. Association between the presence of enterococcal virulence factors gelatinase, hemolysin, and enterococcal surface protein and mortality among patients with bacteremia due to Enterococcus faecalis. Clin Infect Dis. 2002 Sep;35(5):570-5.

17.Camargo IL, Gilmore MS, Darini, AL.  Multilocus sequence typing and analysis of putative virulence factors in vancomycin-resistant and vancomycin-sensitive Enterococcus faecium isolates from Brazil. Clin Microbiol Infect. 2006 Nov;12(11):1123-30.

18.Zou LK, Wang HN, Zeng B, Li JN, Li XT, Zhang AY, Zhou YS, Yang X, Xu CW, Xia QQ. Erythromycin resistance and virulence genes in Enterococcus faecalis from swine in China.New Microbiol.2011 Jan;34(1):73-80.

19.Banerjee T, Anupurba S. Prevalence of Virulence Factors and Drug Resistance in Clinical Isolates of Enterococci: A Study from North India. J Pathog. 2015;p.692612.

20.Diani M, Esiyok OG, Ariafar MN, Yuksel FN, Altuntas EG, Akcelik N. The interactions between esp, fsr, gelE genes and biofilm formation and pfge analysis of clinical Enterococcus faecium strains. Afr J Microbiol Res. 2014 Jan;8(2):129-37.

21.Sieńko A, Wieczorek P, Majewski P, Ojdana D, Wieczorek A, Olszańska D, Tryniszewska E. Comparison of antibiotic resistance and virulence between biofilm-producing and non-producing clinical isolates of E. faecium.  Act Biochim Pol.2015;62(4):859-66.

22.Franiczek R, Dolna I, Dworniczek E, Krzyżanowska B, Seniuk A, Piątkowska E. In vitro activity of Tigecycline against clinical isolates of Gram-positive and Gram-negative bacteria displaying different resistance phenol-types. Adv Clin Exp Med. 2008;17:545-51.

23.Praharaj I, Sujatha S, Parija SC. Phenotypic & genotypic characterization of vancomycin resistant Enterococcus isolates from clinical specimens. Indian J Med Res. 2013 Oct;138 (4):549-56.

24.Iwen PC, Kelly DM, Linder J, Hinrichs SH, Dominguez EA, Rupp ME, Patil KD. Change in prevalence and antibiotic resistance of Enterococcus species isolated from blood cultures over an 8-year period. Antimicrob Agents Chemother. 1997 Feb;41(2):494-5.

25.Saeedi B, Hallgren A, Isaksson B, Jonasson J, Nilsson LE, Hanberger H. Genetic relatedness of Enterococcus faecalis isolates with high-level gentamicin resistance from patients bacteraemia in the south east of Sweden 1994-2001. Scand J Infect Dis. 2004;36:405-9.

26.Paganelli FL, Willems RJ, Jansen P, Hendrickx A, Zhang X, Bonten MJ, Leavis HL. Enterococcus faecium biofilm formation: identification of major autolysin AtlAEfm, associated Acm surface localization, and AtlAEfm-independent extracellular DNA Release. MBio. 2013 Apr;4(2)e00154.

27.Sindhanai V, Avanthiga SS, Suresh Chander VC. Antibiotic Susceptibility Pattern of Biofilm Forming and Biofilm Non Forming Enterococci Species. IOSR-JDMS 2016;15:33-7.

28.Hallgren A, Claesson C, Saeedi B, Monstein HJ, Hanberger H, Nilsson LE. Molecular detection of aggregation substance, enterococcal surface protein, and cytolysin genes and in vitro adhesion to urinary catheters of E. faecalis and E. faecium. Int J Med Microbiol. 2009 Jun;299 (5):323-32.

29.Vankerckhoven V, Van Autgaerden T, Vael C, Lammens C, Chapelle S, Rossi R,  Jabes D, Goossens H. Development of a Multiplex PCR for the Detection of asa1, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium. J Clin Microbiol.  2004 Oct;42(10):4473-9.

30.Comerlato CB, Resende MC, Caierão J, d'Azevedo PA. Presence of virulence factors in Enterococcus faecalis and Enterococcus faecium susceptible and resistant to vancomycin. Mem Inst Oswaldo Cruz. 2013 Aug;108(5):590-5.